zymo spin ic columns (Zymo Research)
Zymo Research is a verified supplier 
Zymo Research manufactures this product 
96
Structured Review
Zymo Research
zymo spin ic columns
Zymo Spin Ic Columns, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 622 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/zymo+spin+ic+columns/Zymo-Spin+IC+Columns/pm42895197-103-12-12
Average 96 stars, based on 622 article reviews
Zymo Spin Ic Columns, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 622 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/zymo+spin+ic+columns/Zymo-Spin+IC+Columns/pm42895197-103-12-12
Average 96 stars, based on 622 article reviews
zymo spin ic columns - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Isolation:Article Title: Circulating miR-21-5p and miR-223-3p as diagnostic biomarkers for rheumatoid arthritis in a sub-Saharan African cohort: a hospital-based case-control study. Article Snippet: .. Total RNA including small RNAs was isolated from 200 μL plasma using the Quick-RNA MicroPrep Kit (Zymo Research, Cat. No. R1050) per the manufacturer's protocol: lysis in 400 μL RNA Lysis Buffer, addition of 200 μL 100% ethanol, column purification on Clinical Proteomics:Article Title: Circulating miR-21-5p and miR-223-3p as diagnostic biomarkers for rheumatoid arthritis in a sub-Saharan African cohort: a hospital-based case-control study. Article Snippet: .. Total RNA including small RNAs was isolated from 200 μL plasma using the Quick-RNA MicroPrep Kit (Zymo Research, Cat. No. R1050) per the manufacturer's protocol: lysis in 400 μL RNA Lysis Buffer, addition of 200 μL 100% ethanol, column purification on Lysis:Article Title: Circulating miR-21-5p and miR-223-3p as diagnostic biomarkers for rheumatoid arthritis in a sub-Saharan African cohort: a hospital-based case-control study. Article Snippet: .. Total RNA including small RNAs was isolated from 200 μL plasma using the Quick-RNA MicroPrep Kit (Zymo Research, Cat. No. R1050) per the manufacturer's protocol: lysis in 400 μL RNA Lysis Buffer, addition of 200 μL 100% ethanol, column purification on Article Title: Evaluating Sequencing Strategies for Endometrial Microbiome Profiling in Endometrial Cancer: A Comparative Study of Short- and Long-Read 16S rRNA Approaches. Article Snippet: Genomic DNA was extracted using a ZymoBIOMICS DNA Microprep Kit (Zymo Research), with minor modifications to enhance microbial lysis. .. Briefly, 1 mL of swab/cell lysate (in DNA/RNA shield) was transferred to BashingBead Lysis Tubes and subjected to mechanical disruption using a Disruptor Genie bead beater (Scientific Industries) at maximum speed for 20 min. Lysates were centrifuged at 10 000 × g for 1 min, and 400 μL of supernatant was mixed with DNA Binding Buffer and applied to Article Title: Evaluating Sequencing Strategies for Endometrial Microbiome Profiling in Endometrial Cancer: A Comparative Study of Short‐ and Long‐Read 16S rRNA Approaches Article Snippet: Genomic DNA was extracted using a ZymoBIOMICS DNA Microprep Kit (Zymo Research), with minor modifications to enhance microbial lysis. .. Briefly, 1 mL of swab/cell lysate (in DNA/RNA shield) was transferred to BashingBead Lysis Tubes and subjected to mechanical disruption using a Disruptor Genie bead beater (Scientific Industries) at maximum speed for 20 min. Lysates were centrifuged at 10 000 × g for 1 min, and 400 μL of supernatant was mixed with DNA Binding Buffer and applied to Purification:Article Title: Circulating miR-21-5p and miR-223-3p as diagnostic biomarkers for rheumatoid arthritis in a sub-Saharan African cohort: a hospital-based case-control study. Article Snippet: .. Total RNA including small RNAs was isolated from 200 μL plasma using the Quick-RNA MicroPrep Kit (Zymo Research, Cat. No. R1050) per the manufacturer's protocol: lysis in 400 μL RNA Lysis Buffer, addition of 200 μL 100% ethanol, column purification on Article Title: Nuclear β-actin–dependent chromatin accessibility governs stem cell pluripotency and extracellular matrix gene programs to maintain cellular biomechanics for cell lineage decisions Article Snippet: .. Following transposition, DNA was purified using Article Title: DNA methylation-mediated memory of obesity in CD4 T lymphocytes perpetuates immune dysregulation. Article Snippet: DNA (100–200 ng) was digested with MspI at 37 °C for 4 h, followed by A-tailing and adapter ligation using the reagents and thermocycler conditions specified in the Zymo protocol. .. Bisulfite conversion was performed with the Zymo conversion reagents, involving incubation at 98 °C for 8 min and 54 °C for 1 h. Converted DNA was purified using Disruption:Article Title: Evaluating Sequencing Strategies for Endometrial Microbiome Profiling in Endometrial Cancer: A Comparative Study of Short- and Long-Read 16S rRNA Approaches. Article Snippet: Genomic DNA was extracted using a ZymoBIOMICS DNA Microprep Kit (Zymo Research), with minor modifications to enhance microbial lysis. .. Briefly, 1 mL of swab/cell lysate (in DNA/RNA shield) was transferred to BashingBead Lysis Tubes and subjected to mechanical disruption using a Disruptor Genie bead beater (Scientific Industries) at maximum speed for 20 min. Lysates were centrifuged at 10 000 × g for 1 min, and 400 μL of supernatant was mixed with DNA Binding Buffer and applied to Article Title: Evaluating Sequencing Strategies for Endometrial Microbiome Profiling in Endometrial Cancer: A Comparative Study of Short‐ and Long‐Read 16S rRNA Approaches Article Snippet: Genomic DNA was extracted using a ZymoBIOMICS DNA Microprep Kit (Zymo Research), with minor modifications to enhance microbial lysis. .. Briefly, 1 mL of swab/cell lysate (in DNA/RNA shield) was transferred to BashingBead Lysis Tubes and subjected to mechanical disruption using a Disruptor Genie bead beater (Scientific Industries) at maximum speed for 20 min. Lysates were centrifuged at 10 000 × g for 1 min, and 400 μL of supernatant was mixed with DNA Binding Buffer and applied to Binding Assay:Article Title: Evaluating Sequencing Strategies for Endometrial Microbiome Profiling in Endometrial Cancer: A Comparative Study of Short- and Long-Read 16S rRNA Approaches. Article Snippet: Genomic DNA was extracted using a ZymoBIOMICS DNA Microprep Kit (Zymo Research), with minor modifications to enhance microbial lysis. .. Briefly, 1 mL of swab/cell lysate (in DNA/RNA shield) was transferred to BashingBead Lysis Tubes and subjected to mechanical disruption using a Disruptor Genie bead beater (Scientific Industries) at maximum speed for 20 min. Lysates were centrifuged at 10 000 × g for 1 min, and 400 μL of supernatant was mixed with DNA Binding Buffer and applied to Article Title: Evaluating Sequencing Strategies for Endometrial Microbiome Profiling in Endometrial Cancer: A Comparative Study of Short‐ and Long‐Read 16S rRNA Approaches Article Snippet: Genomic DNA was extracted using a ZymoBIOMICS DNA Microprep Kit (Zymo Research), with minor modifications to enhance microbial lysis. .. Briefly, 1 mL of swab/cell lysate (in DNA/RNA shield) was transferred to BashingBead Lysis Tubes and subjected to mechanical disruption using a Disruptor Genie bead beater (Scientific Industries) at maximum speed for 20 min. Lysates were centrifuged at 10 000 × g for 1 min, and 400 μL of supernatant was mixed with DNA Binding Buffer and applied to Incubation:Article Title: Microphysiological organ-on-a-chip system for anti-doping research: long-term CYP activity characterization and S107 metabolism in a HepaRG™-based 3D liver model. Article Snippet: Identification of metabolic markers of prohibited and emerging performance-enhancing substances remains a key challenge in anti-doping analysis, where limitations of conventional in vitro models in resembling authentic physiological conditions exist.. Organ-on-a-chip (OoC) systems combining 3D human liver-cell cultures with microfluidic perfusion offer a predictive alternative for human-like drug metabolism.. In this study, a HepaRGTM-based liver OoC model incorporating hepatic stellate cells was characterized over a three-week period with a focus on cytochrome P450 (CYP)-mediated metabolism. Article Title: DNA methylation-mediated memory of obesity in CD4 T lymphocytes perpetuates immune dysregulation. Article Snippet: DNA (100–200 ng) was digested with MspI at 37 °C for 4 h, followed by A-tailing and adapter ligation using the reagents and thermocycler conditions specified in the Zymo protocol. .. Bisulfite conversion was performed with the Zymo conversion reagents, involving incubation at 98 °C for 8 min and 54 °C for 1 h. Converted DNA was purified using Gene Knockout:Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and DNA Clean up Kit or the DNA Clean & Concentrator KitTM-5 with Sequencing:Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and DNA Clean up Kit or the DNA Clean & Concentrator KitTM-5 with Polymerase Chain Reaction:Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and DNA Clean up Kit or the DNA Clean & Concentrator KitTM-5 with Concentration Assay:Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and DNA Clean up Kit or the DNA Clean & Concentrator KitTM-5 with Amplification:Article Title: Compositions and methods for enzyme immobilization Article Snippet: .. TABLE 6 Information on primer sets for testing min gene knockout Name Annealing Sequence Designation 3′minCKO_1 GGCCGGATAAAACTTGTGCT 1 (SEQ ID NO:37) 3′minCKO_2 AGTCTTCGGAACATCATCGC 2 (SEQ ID NO:38) 5′minCKO_1 CCCTTTGCCCGAAGTAACAA 3 (SEQ ID NO:39) 5′minCKO_2 ACGGTGAAAACCTGGCCTAT 4 (SEQ ID NO:40) minC_check_4_1 TCAATTTAACGGTTGAACGGTCA 5 (SEQ ID NO:41) minC_check_4_2 ATGTCAAACACGCCAATCGA 6 (SEQ ID NO:42) minD_check_2_1 TTATCCTCCGAACAAGCGTTTGA 7 (SEQ ID NO:43) minD_check_2_2 ATGGCACGCATTATTGTTGTTAC 8 (SEQ ID NO:44) TABLE 7 Components for PCR reaction Component 50 uL Reaction Final Concentration 10 uM Forward Primer 2.5 uL 0.5 uM 10 uM Reverse Primer 2.5 uL 0.5 uM DMSO 1.5 uL 3% 2X Phusion Master Mix 25 uL 1x Genomic DNA 1 uL 2 ng/uL Nuclease Free Water 17.5 uL N/A TABLE 8 Conditions for PCR reaction Conditions 55 Cycles Steps Temperature (° C.) Time (seconds) Initial Denaturation 98 30 Cycle Denaturation 98 10 Cycle Annealing 65, 5o Gradient 30 Cycle Extension 72 30 Final Extension 72 600 Hold 4 N/A TABLE 9 Information on annealing temperatures for PCR reaction Annealing Temperatures Tm Number Tm ° C. 1 59.9 2 61.3 3 63.8 4 66.6 5 69.7 6 67.6 After PCR amplification, all products were cleaned up using either the Monarch® PCR and DNA Clean up Kit or the DNA Clean & Concentrator KitTM-5 with Article Title: DNA methylation-mediated memory of obesity in CD4 T lymphocytes perpetuates immune dysregulation. Article Snippet: DNA (100–200 ng) was digested with MspI at 37 °C for 4 h, followed by A-tailing and adapter ligation using the reagents and thermocycler conditions specified in the Zymo protocol. .. Bisulfite conversion was performed with the Zymo conversion reagents, involving incubation at 98 °C for 8 min and 54 °C for 1 h. Converted DNA was purified using other:Article Title: Multiplexed single-cell reduced representation bisulfite sequencing for genome-wide DNA methylation profiling. Article Snippet: DNA methylation is a fundamental epigenetic modification that regulates gene expression, maintains genomic integrity and defines cellular identity.. Conventional bulk sequencing methods, such as reduced-representation bisulfite sequencing (RRBS), have elucidated genome-wide methylation landscapes but do not reveal cell-to-cell variation, limiting insights into methylation heterogeneity during development, differentiation and disease.. Here, we present multiplexed single-cell RRBS (Msc-RRBS), a streamlined and scalable protocol for parallel DNA methylation profiling of hundreds of individual cells. |